The molecular basis of cell differentiation d | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) Cell differentiation is the process by which a less specialized cell becomes a more specialized cell type. This process is primarily controlled by

Vedclass · Accepted Answer

Transcription factors

Vedclass · Answer

(C) Cell differentiation is the process by which a less specialized cell becomes a more specialized cell type. This process is primarily controlled by the differential expression of genes. The regulation of gene expression,which determines which genes are turned on or off in a specific cell type,is largely mediated by $Transcription$ $factors$. These proteins bind to specific $DNA$ sequences to regulate the transcription of genetic information from $DNA$ to messenger $RNA$ $(mRNA)$,thereby controlling the protein synthesis profile of the cell.

The molecular basis of cell differentiation depends on the regulation of:

Similar Questions

In a transcription unit,the promoter is located towards the .......

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Transcription is

What is correct for bacterial transcription?

Which one of the following is not a part of a transcription unit in $DNA$?

Vedclass Test Series

Exam Paper Generator

Online Exam Module