If the sequence of the coding strand in a transcription unit is $GACTTAGCCA$,what will be the sequence of the $RNA$ formed from this transcription unit?
- A$CTGAATCGGT$
- B$CUGAAUCGGU$
- C$GACTTAGCCA$
- D$GACUUAGCCA$
Explore More
Similar Questions
Which of the following is responsible for the transcription of $tRNA$ and $snRNAs$?
Medium
View SolutionWhich one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$
$3'TACATGGCAAATATCCATTCA5'$
MediumNEET 2024
View SolutionWhich of the following is correct for $m-RNA$ in eukaryotes?
Medium
View SolutionDuring transcription,if the nucleotide sequence of the $DNA$ strand that is being coded is $ATACG$,then the nucleotide sequence in the $mRNA$ would be:
MediumAIPMT 2004
View SolutionWhich one of the following processes is exclusively concerned with transcription?
Medium
View SolutionVedclass Products
For Students
Vedclass Test Series
Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.
Start Free TrialFor Teachers
Exam Paper Generator
Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.
Try FreeFor Institutes
Online Exam Module
Live online exams with unlimited students, 360° analytics & white-label branding.
See Demo