What is the primary role of prokaryotic RNA p | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In prokaryotes, a single type of $RNA$ polymerase is responsible for the transcription of all types of $RNA$ ($mRNA$, $tRNA$, and $rRNA$).This enz

Vedclass · Accepted Answer

All of the above

Vedclass · Answer

(D) In prokaryotes, a single type of $RNA$ polymerase is responsible for the transcription of all types of $RNA$ ($mRNA$, $tRNA$, and $rRNA$).This enzyme follows the three major steps of transcription: $1$. Initiation: The $RNA$ polymerase binds to the promoter region with the help of the sigma ($\sigma$) factor.$2$. Elongation: The enzyme facilitates the polymerization of ribonucleotides to form the $RNA$ chain.$3$. Termination: The enzyme recognizes the terminator sequence and releases the nascent $RNA$ chain with the help of the rho ($\rho$) factor.Since the $RNA$ polymerase is involved in all three stages, the correct answer is $D$.

What is the primary role of prokaryotic $RNA$ polymerase in the process of transcription?

Similar Questions

Which process is represented in the given figure?

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Identify $a, b$ and $c$ based on the provided image of the transcription process.

$RNA$ polymerase-$I$ transcribes eukaryotic ribosomal $RNA$ which does not consist of: (in $S$ $rRNA$)

Select the correct option regarding the direction of $RNA$ synthesis and the direction of reading of the template $DNA$ strand:

Vedclass Test Series

Exam Paper Generator

Online Exam Module