Which specific processes does hnRNA undergo i | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In eukaryotic cells,the primary transcript $hnRNA$ (heterogeneous nuclear $RNA$) is non-functional and undergoes three major post-transcriptional

Vedclass · Accepted Answer

All of the above

Vedclass · Answer

(D) In eukaryotic cells,the primary transcript $hnRNA$ (heterogeneous nuclear $RNA$) is non-functional and undergoes three major post-transcriptional modifications to become functional $mRNA$:$1$. Capping: $A$ methyl guanosine triphosphate is added to the $5'$ end of $hnRNA$.$2$. Splicing: The non-coding introns are removed,and the coding exons are joined in a defined order.$3$. Tailing (Polyadenylation): Adenylate residues are added at the $3'$ end in a template-independent manner.Therefore,all these processes are essential for the maturation of $hnRNA$.

Which specific processes does $hnRNA$ undergo in eukaryotic cells?

Similar Questions

The regions located upstream of the $5'$ end and downstream of the $3'$ end of a structural gene are respectively known as:

What function is performed by sigma factor and rho factor in the process of transcription?

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Segments of $mRNA$ removed during splicing are called......

If a $DNA$ strand has the base sequence $5'-AAAA-3'$,then the base sequence of the complementary $m-RNA$ is:

Vedclass Test Series

Exam Paper Generator

Online Exam Module