Select the incorrect option for transcription | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In prokaryotes,transcription is simpler than in eukaryotes. $1$. Only a single type of $RNA$ polymerase is involved in the transcription of all ty

Vedclass · Accepted Answer

All of the above.

Vedclass · Answer

(D) In prokaryotes,transcription is simpler than in eukaryotes. $1$. Only a single type of $RNA$ polymerase is involved in the transcription of all types of $RNA$ ($mRNA$,$tRNA$,and $rRNA$) in bacteria. $2$. Prokaryotic $mRNA$ does not require processing such as splicing (removal of introns),capping (addition of $7$-methylguanosine at the $5'$ end),or polyadenylation (addition of poly-$A$ tail at the $3'$ end). $3$. These processes are characteristic of eukaryotic transcription. Therefore,all the given options ($A$,$B$,and $C$) are incorrect regarding prokaryotic transcription,making $D$ the correct choice.

Select the incorrect option for transcription in prokaryotes.

Similar Questions

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

The process of synthesis of $m-RNA$ from $DNA$ is called .......

Removal of introns and joining the exons in a defined order in a transcription unit is called

Which type of $RNA$ is transcribed by $RNA$ polymerase $III$?

The process of transcription follows which principle?

Vedclass Test Series

Exam Paper Generator

Online Exam Module