(C) The process of copying genetic information from one strand of the $DNA$ into $RNA$ is known as $Transcription$. $Replication$ is the process of du

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

(C) The process of copying genetic information from one strand of the $DNA$ into $RNA$ is known as $Transcription$. $Replication$ is the process of duplicating $DNA$. $Translation$ is the process of synthesizing proteins from $mRNA$. $Transformation$ refers to the uptake of foreign genetic material by a cell.

Class 12 Biology Molecular Basis of Inheritance Transcription

Medium

The process of copying genetic information from one strand of the $DNA$ into $RNA$ is termed as .....

A
Replication
B
Transformation
C
Transcription
D
Translation

Explore More

Browse All

Question Bank

All Subjects

Class 12 Questions

Class 12

Biology Questions

Chapter

Molecular Basis of Inheritance

Subtopic

Transcription

What happens during the process of capping in eukaryotic $mRNA$ processing?

Medium

View Solution

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

MediumNEET 2024

View Solution

Where is the transcription unit found?

Easy

View Solution

In processing of eukaryotic $hnRNA$,during protein synthesis,tailing involves . . . . . . of $RNA$.

EasyMHT CET 2015

View Solution

Which $RNA$ carries information from $DNA$ in protein synthesis?

Medium

View Solution

Vedclass Products

For Students

Vedclass Test Series

Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.

Start Free Trial

For Teachers

Exam Paper Generator

Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.

Try Free

For Institutes

Online Exam Module

Live online exams with unlimited students, 360° analytics & white-label branding.

See Demo

The process of copying genetic information from one strand of the $DNA$ into $RNA$ is termed as .....

Similar Questions

What happens during the process of capping in eukaryotic $mRNA$ processing?

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?$3'TACATGGCAAATATCCATTCA5'$

Where is the transcription unit found?

In processing of eukaryotic $hnRNA$,during protein synthesis,tailing involves . . . . . . of $RNA$.

Which $RNA$ carries information from $DNA$ in protein synthesis?

Vedclass Test Series

Exam Paper Generator

Online Exam Module

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$