During transcription,if the nucleotide sequen | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) During the process of transcription,the $DNA$ template strand is used to synthesize $mRNA$ through complementary base pairing.In $DNA$,the base $A

Vedclass · Accepted Answer

$UAUGC$

Vedclass · Answer

(A) During the process of transcription,the $DNA$ template strand is used to synthesize $mRNA$ through complementary base pairing.In $DNA$,the base $Adenine$ $(A)$ pairs with $Thymine$ $(T)$,$Thymine$ $(T)$ pairs with $Adenine$ $(A)$,$Guanine$ $(G)$ pairs with $Cytosine$ $(C)$,and $Cytosine$ $(C)$ pairs with $Guanine$ $(G)$.However,in $RNA$,$Uracil$ $(U)$ replaces $Thymine$ $(T)$.Therefore,the base pairing rules for $DNA$ to $mRNA$ transcription are:$A$ $(DNA)$ $\rightarrow$ $U$ (mRNA)$T$ $(DNA)$ $\rightarrow$ $A$ (mRNA)$C$ $(DNA)$ $\rightarrow$ $G$ (mRNA)$G$ $(DNA)$ $\rightarrow$ $C$ (mRNA)Given the $DNA$ template sequence $ATACG$:$A \rightarrow U$$T \rightarrow A$$A \rightarrow U$$C \rightarrow G$$G \rightarrow C$Thus,the resulting $mRNA$ sequence is $UAUGC$.

During transcription,if the nucleotide sequence of the $DNA$ template strand is $ATACG$,what will be the nucleotide sequence in the $mRNA$?

Similar Questions

Identify the enzyme that helps in unwinding the $DNA$ helix during transcription.

In tailing,adenylate residues are added at the $3'$ end of $mRNA$:

What is the role of $RNA$ polymerase $III$ in the process of transcription in Eukaryotes?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

$RNA$ polymerase binds to the .........

Vedclass Test Series

Exam Paper Generator

Online Exam Module