A mature eukaryotic m-RNA is identified by: | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(B) In eukaryotic cells,the primary transcript (pre-$mRNA$) undergoes post-transcriptional modifications to become mature $mRNA$. $1$. Capping: $A$ $7

Vedclass · Accepted Answer

$5'$ end having $7-methyl$ guanosine cap and $3'$ end having poly-$A$ tail

Vedclass · Answer

(B) In eukaryotic cells,the primary transcript (pre-$mRNA$) undergoes post-transcriptional modifications to become mature $mRNA$. $1$. Capping: $A$ $7-methyl$ guanosine $(m^7G)$ cap is added to the $5'$ end of the transcript. $2$. Tailing: $A$ poly-$A$ tail (a sequence of adenine nucleotides) is added to the $3'$ end. $3$. Splicing: Introns are removed,and exons are joined together. These modifications protect the $mRNA$ from degradation and facilitate its transport and translation. Therefore,the presence of a $5'$ cap and a $3'$ poly-$A$ tail is the hallmark of a mature eukaryotic $mRNA$.

$A$ mature eukaryotic $m-RNA$ is identified by:

Similar Questions

The process of copying genetic information from one strand of $DNA$ into $RNA$ is termed as .....

The central dogma of protein synthesis is

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Choose the correct statement.

Which enzyme plays an important role in transcription?

Vedclass Test Series

Exam Paper Generator

Online Exam Module