$DNA$-dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the

The $DNA$ strand on which $DNA$-dependent $RNA$ polymerase catalyzes transcription is called:

What is meant by the sense strand?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

$Statement A$: The primary transcript produced in eukaryotes is translated without undergoing any modification or processing.
$Statement B$: The $hnRNA$ in humans has exons and introns.

What does $X$ represent in the following diagram?