If the sequence of the coding strand in a tex | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In a $	ext{DNA}$ molecule,the coding strand has the same sequence as the $	ext{mRNA}$ transcript,except that thymine $(T)$ in $	ext{DNA}$ is re

Vedclass · Accepted Answer

$	ext{5'-AUCGAUCGACUG-3'}$

Vedclass · Answer

(D) In a $	ext{DNA}$ molecule,the coding strand has the same sequence as the $	ext{mRNA}$ transcript,except that thymine $(T)$ in $	ext{DNA}$ is replaced by uracil $(U)$ in $	ext{RNA}$.Given coding strand: $	ext{5'-ATCGATCGACTG-3'}$.Since the $	ext{mRNA}$ is complementary to the template strand and identical to the coding strand (with $U$ instead of $T$),the $	ext{mRNA}$ sequence will be $	ext{5'-AUCGAUCGACUG-3'}$.Therefore,the correct option is $D$.

If the sequence of the coding strand in a $\text{DNA}$ molecule is $\text{5'-ATCGATCGACTG-3'}$,then the sequence of $\text{RNA}$ transcribed from the template strand would be:

Similar Questions

In tailing,adenylate residues are added at the $3'$ end of $mRNA$:

Identify the correct set of labels for the given diagram of a transcription unit.

Find out the incorrect statement.

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Vedclass Test Series

Exam Paper Generator

Online Exam Module