What is the process by which genetic information is transferred from $DNA$ to $RNA$?

Which factor$(s)$ participate in the process of transcription in prokaryotes?

Compare the statements $A$ and $B$.
$Statement A$: $RNA$ produced during transcription in eukaryotic cells cannot be straight away used in translation.
$Statement B$: $RNA$ splicing phenomena helps in the removal of exons.
Choose the correct description.

In which direction is $m-RNA$ synthesized on a $DNA$ template?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Explain different types of $RNA$ and explain the process of transcription.