Name the enzyme that facilitates the opening | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) During the process of transcription,the enzyme $RNA$ polymerase is responsible for both the unwinding of the $DNA$ double helix and the synthesis

Vedclass · Accepted Answer

$RNA$ polymerase

Vedclass · Answer

(A) During the process of transcription,the enzyme $RNA$ polymerase is responsible for both the unwinding of the $DNA$ double helix and the synthesis of the $RNA$ strand. Unlike replication,where $DNA$ helicase is used to unwind the helix,transcription relies on the $RNA$ polymerase holoenzyme to initiate the separation of the $DNA$ strands at the promoter site.

Name the enzyme that facilitates the opening of the $DNA$ helix during transcription.

Similar Questions

Which of the following is not a part of a transcription unit in $DNA$?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Which enzyme is responsible for the synthesis of $18S$ $rRNA$?

Transcription is the process of synthesis of:

What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?

Vedclass Test Series

Exam Paper Generator

Online Exam Module