Assertion: In text{RNA} processing occurs in | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) In eukaryotes,the primary transcript (pre-mRNA) contains both exons (coding sequences) and introns (non-coding sequences).This arrangement is know

Vedclass · Accepted Answer

Both Assertion $\&$ Reason are True $\&$ the Reason is a correct explanation of the Assertion.

Vedclass · Answer

(A) In eukaryotes,the primary transcript (pre-mRNA) contains both exons (coding sequences) and introns (non-coding sequences).This arrangement is known as a split gene.Because introns do not code for proteins,they must be removed through a process called splicing.Additionally,the pre-mRNA undergoes capping and tailing to become functional mRNA.Since the presence of split genes (introns) necessitates the removal of non-coding sequences,$RNA$ processing is essential in eukaryotes.Therefore,both the assertion and the reason are true,and the reason correctly explains why $RNA$ processing occurs.

Assertion: In $\text{RNA}$ processing occurs in Eukaryotes.
Reason: Eukaryotes have split gene.

Similar Questions

During transcription,the holoenzyme $RNA$ polymerase binds to the $DNA$ strand. It forms a structure resembling a saddle at a specific site on the $DNA$. This sequence is called .....

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

$RNA$ splicing, capping and tailing occurs in . . . . . . of the cell.

What happens when the sigma factor $(\sigma)$ binds to the $RNA$ polymerase?

If the sequence of nitrogenous bases in $DNA$ is $ATTCGATG$,what will be the sequence of bases in the $mRNA$ transcript?

Vedclass Test Series

Exam Paper Generator

Online Exam Module

Assertion: In $\text{RNA}$ processing occurs in Eukaryotes.Reason: Eukaryotes have split gene.