Identify the INCORRECT statement with referen | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) In a transcription unit,the $DNA$ strand with polarity $3' \rightarrow 5'$ acts as the template strand,and the strand with $5' \rightarrow 3'$ pol

Vedclass · Accepted Answer

The transcribed $RNA$ is similar to the antisense strand of $DNA$ except it has Uracil base in place of Thymine.

Vedclass · Answer

(C) In a transcription unit,the $DNA$ strand with polarity $3' \rightarrow 5'$ acts as the template strand,and the strand with $5' \rightarrow 3'$ polarity acts as the coding strand.Option $A$ is correct: The promoter is located at the $5'$ end of the structural gene (upstream).Option $B$ is correct: $DNA$ dependent $RNA$ polymerase catalyzes polymerization only in the $5' \rightarrow 3'$ direction.Option $C$ is incorrect: The transcribed $RNA$ is complementary to the template strand (antisense strand) and identical to the coding strand (sense strand),except for the presence of Uracil instead of Thymine. It is not similar to the antisense strand.Option $D$ is correct: The terminator is located at the $3'$ end of the coding strand (downstream).

Identify the $INCORRECT$ statement with reference to transcription unit.

Similar Questions

Select the correct option regarding the direction of $RNA$ synthesis and the direction of reading of the template $DNA$ strand:

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

During transcription,the $DNA$ strand which acts as a template is called $A$ strand and it has $B$ polarity.

Give scientific reasons: Transcription and translation could be coupled in prokaryotic cell but not in eukaryotic cell.

If the sequence of bases on the coding strand of $DNA$ is $AAGCCTATCAG$,what will be the sequence of bases on the $mRNA$?

Vedclass Test Series

Exam Paper Generator

Online Exam Module