Poly A tail is present in | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In eukaryotes,the primary transcript (pre-$mRNA$) undergoes post-transcriptional modifications.One of these modifications is polyadenylation,where

Vedclass · Accepted Answer

$mRNA$ of eukaryotes

Vedclass · Answer

(D) In eukaryotes,the primary transcript (pre-$mRNA$) undergoes post-transcriptional modifications.One of these modifications is polyadenylation,where a poly-$A$ tail (consisting of $200-300$ adenine residues) is added to the $3'$ end of the $mRNA$ molecule.This tail protects the $mRNA$ from degradation and assists in its export from the nucleus to the cytoplasm.Therefore,the poly-$A$ tail is a characteristic feature of eukaryotic $mRNA$.

Poly $A$ tail is present in

Similar Questions

If the sequence of the coding strand in a transcription unit is $GACTTAGCCA$,what will be the sequence of the $RNA$ formed from this transcription unit?

$DNA$-dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

What is the role of $RNA$ polymerase $III$ in the process of transcription in Eukaryotes?

$RNA$ processing is:

Vedclass Test Series

Exam Paper Generator

Online Exam Module